PCR amplification of 16s rDNA

Ribosomal DNA was amplified directly from a single colony grown on agar LB plates using Taq polymerase as recommended by the manufacturer (Sigma, Aldrich).
      Reaction mixtures contained 2mM MgCl2, 10mM TrisHCl, pH 8.3, 50mM KCl 200*M deoxynucleoside triphosphates, 2.5 units of Thermus aquaticus DNA polymerase, 0.2 *M of each oligonucleotide primer. Thermal cycling was as follows: denaturation at 95°C for 1.5 min., annealing at 55°C or 60 °C for 1.5 min. and extension at 72°C for 1.5 min. for a total of 30 cycles.
      The oligonucleotide primer sequences to identify and amplify rDNA genes were as follows:

EubacF: agagtttgatcctggctcag; EubactR: ggttaccttgttacgactt, for eubacteria;
ArcheaF: ttccggttgatccygccgga; ArcheaR: yccggcgttgamtccaatt, for archea;
EukF: aacctggttgatcctgccagt; EukR: tgatccttctgcaggttcacctac, for eukaryotes.

Ribosomal DNA Cloning and Sequencing

PCR amplified DNA, after the purification using the Nucleospin® Extract, a ready to use system for direct and fast purification of PCR products from agarose gels (Macherey-Nagel), was directly sequenced using Thermo Sequenase Cy 5.5 Dye Terminator Cycle Sequencing kit following the protocol suggested by the manufacturer (Amersham Pharmacia Biotech). The products were separated in a gel matrix using the automated sequencing instrument SeQ 4x4 personal sequencer system. The purified, amplified eubacterial rDNAs were cloned by using the SureClone TM Ligation kit (Amersham Pharmacia Biotech). Insert-containing clones were identified by agarose gel electrophoresis of small-scale plasmid preparation (Maniatis et a., 1982). Plasmid templates were sequenced as reported above.

Phylogenetic Analyses

Determined sequences were aligned to previously determined rDNA sequences using the program Clustal W at http://www.ddbj.nig.ac.jp.

RAPD analyses

A total of 6 RAPD primers were tested for their ability to provide informative and reproducible RAPD profiles. RAPD1 (5'ggtttccgccc3'), RAPD2 (5'ggatcctgac3'), RAPD3 (5'cggcccctgt3'), RAPD4 (5'tcccgctgcg3'), RAPD2T (5'ggttcctgtc 3'), RAPD4C(5'agggcgacgc 3').
The results of the experiments with primer 1 and 2 are reported here, because they show clearly that the different clones have different genetic profiles. The PCR reaction mixture (25ml) contained 1X PCR buffer supplemented wih 3mM MgCl2 solution (Sigma Aldrich) 200mM each of the four deoxynucleoside triphosphates (dNTPs, Amersham Pharmacia Biotech), 500ng of one or two 10 nucleotide primers (MWG-Biotech AG) 0.5 U of Taq DNA Polymerase (Sigma-Aldrich) and a small part of a single colony from agarose plate. PCR amplification was performed on a Perkin Elmer 2400 Thermal Cycler using the following cycling program: after denaturation at 94°C for 3 min., the reaction mixtures undergo 45 cicles of denaturation at 94°C for 0.5min., annealing at 32°C for 1min. and extension at 72°C for 2 min., with an additional final 10min. extension at 72°C. 15ml of each amplification products were separed on 1% agarose gel stained with 0.5mg/ml ethidium bromide, examined and photographed under a UV light. A 1.0 kb ladder DNA sample (MBI Fermentas) was used as a molecular weight marker. The RAPD reproducibility was established running all reactions in three independent experiments.

Scanning Electron Microscopy.

These analyses were performed in the "Centro Interdipartimentale di Microscopia Elettronica" of the University of Naples Federico II.